Logo

The clonoSEQ® Report

The clonoSEQ testing process

When used to measure residual disease in lymphoid malignancies, the clonoSEQ Assay requires two testing steps to be completed sequentially

Looking for clonoSEQ results?

Visit our customer portal.

log in

First report: Clonality (ID) report

The Clonality (ID) Report provides an overview of the dominant DNA sequences identified in a patient sample collected during diagnostic workup. These dominant sequences are typically associated with malignancy and will be used by the clonoSEQ Assay as the basis for MRD detection.[1]

The Clonality (ID) Report is the first report that a clinician receives upon initiating clonoSEQ testing for a new patient.

Example Clonality Sequence:

DOMINANT DNA SEQUENCE(S) IDENTIFIED

Specific to your patient’s cancer

AATACGATACGCATTTCAGCATCGCAT

Present in 71% of total nucleated cells

TTCGACTCAGACGCGAATCAGCATCA

Present in 70% of total nucleated cells

The Clonality (ID) Test is used to identify dominant DNA sequences in a high disease load diagnostic sample

Identification of at least one dominant DNA sequence is a prerequisite to future monitoring of MRD. After the dominant DNA sequence(s) have been identified utilizing the Clonality (ID) Test, subsequent monitoring of the associated clone can be completed by ordering Tracking (MRD) Tests.

Tap the numbers on the report for more information.

Clonality ID Report page 1123
Clonality ID Report page 24
Clonality ID Report page 35

Subsequent reports: MRD report

The Tracking (MRD) Report summarizes results from MRD testing of patient samples collected during or after treatment.[1] Tracking (MRD) Reports assess and quantify the presence of each tracked DNA sequence and identify any newly-emerging dominant DNA sequences. Since clinicians often assess residual disease repeatedly during the course of a patient’s treatment or remission, many patients will receive multiple Tracking (MRD) Reports over time. Each report includes the results from previous reports, providing a visual representation of disease burden over time that clinicians can map to treatment cycles and communicate to patients.

The clonoSEQ B-cell Tracking (MRD) Report provides results based on analysis of the IgH, IgK, and IgL loci, as well as Bcl1 and Bcl2 translocations

After the dominant DNA sequences has been identified utilizing the Clonality (ID) Test, subsequent monitoring of the associated clone can be completed by ordering Tracking (MRD) Tests throughout treatment.

Tap the numbers on the report for more information.

MRD Tracking Report page 1123
MRD Tracking Report page 245
MRD Tracking Report page 3678
MRD Tracking Report page 491011

This page is intended for a US-based audience.

clonoSEQ® is available as an FDA-cleared in vitro diagnostic (IVD) test service provided by Adaptive Biotechnologies to detect minimal residual disease (MRD) in bone marrow from patients with multiple myeloma or B-cell acute lymphoblastic leukemia (B-ALL) and blood or bone marrow from patients with chronic lymphocytic leukemia (CLL). Additionally, clonoSEQ is available for use in other lymphoid cancers and specimen types as a CLIA validated laboratory developed test (LDT). IGHV testing is available as a CLIA-validated LDT and has not been cleared or approved by the FDA. For important information about the FDA-cleared uses of clonoSEQ including test limitations, please visit clonoSEQ.com/technical-summary.

Citations